---
name: reverse-complement
description: Generate reverse complements and complements of DNA/RNA sequences using Biopython. Use when working with opposite strands, primer design, or converting between template and coding strands.
tool_type: python
primary_tool: Bio.Seq
---
## Version Compatibility
Reference examples tested with: BioPython 1.83+, samtools 1.19+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# Reverse Complement
Generate complementary and reverse complementary sequences using Biopython.
**"Get the reverse complement"** -> Produce the 5'-to-3' sequence of the opposite strand.
- Python: `seq.reverse_complement()` (BioPython `Seq`)
- CLI: `samtools faidx ref.fa region --reverse-complement`
## Required Import
```python
from Bio.Seq import Seq
```
## Core Methods
### reverse_complement()
Returns the reverse complement (5' to 3' of the opposite strand).
```python
seq = Seq('ATGCGATCG')
rc = seq.reverse_complement() # Returns Seq('CGATCGCAT')
```
This is the most commonly used operation - it produces the sequence of the opposite strand in the conventional 5' to 3' direction.
### complement()
Returns the complement without reversing.
```python
seq = Seq('ATGCGATCG')
comp = seq.complement() # Returns Seq('TACGCTAGC')
```
Less commonly used - gives the opposite strand but in 3' to 5' direction.
### reverse_complement_rna()
For RNA sequences (uses U instead of T):
```python
rna = Seq('AUGCGAUCG')
rc_rna = rna.reverse_complement_rna() # Returns Seq('CGAUCGCAU')
```
### complement_rna()
```python
rna = Seq('AUGCGAUCG')
comp_rna = rna.complement_rna() # Returns Seq('UACGCUAGC')
```
## Base Pairing Rules
### DNA
| Base | Complement |
|------|------------|
| A | T |
| T | A |
| G | C |
| C | G |
### RNA
| Base | Complement |
|------|------------|
| A | U |
| U | A |
| G | C |
| C | G |
### Ambiguous Bases (IUPAC)
| Code | Bases | Complement |
|------|-------|------------|
| R | A/G | Y |
| Y | C/T | R |
| S | G/C | S |
| W | A/T | W |
| K | G/T | M |
| M | A/C | K |
| B | C/G/T | V |
| D | A/G/T | H |
| H | A/C/T | D |
| V | A/C/G | B |
| N | A/C/G/T | N |
Biopython handles IUPAC ambiguity codes correctly.
## Code Patterns
### Basic Reverse Complement
```python
seq = Seq('ATGCGATCGATCG')
rc = seq.reverse_complement()
print(f'Original: 5\'-{seq}-3\'')
print(f'RevComp: 5\'-{rc}-3\'')
```
### Visualize Double-Stranded DNA
```python
def show_dsdna(seq):
comp = seq.complement()
print(f"5'-{seq}-3'")
print(f" {'|' * len(seq)}")
print(f"3'-{comp}-5'")
seq = Seq('ATGCGATCG')
show_dsdna(seq)
```
### Check if Sequence is Palindrome (Self-Complementary)
```python
def is_palindrome(seq):
return seq == seq.reverse_complement()
seq1 = Seq('GAATTC') # EcoRI site - palindrome
seq2 = Seq('ATGCGA') # Not a palindrome
print(f'GAATTC is palindrome: {is_palindrome(seq1)}')
print(f'ATGCGA is palindrome: {is_palindrome(seq2)}')
```
### Reverse Complement a FASTA File
**Goal:** Produce a new FASTA file with all sequences reverse-complemented.
**Approach:** Parse records, create new SeqRecords with `.reverse_complement()`, write to output.
```python
from Bio import SeqIO
from Bio.SeqRecord import SeqRecord
def reverse_complement_records(records):
for record in records:
yield SeqRecord(
record.seq.reverse_complement(),
id=record.id + '_rc',
description=record.description + ' reverse complement'
)
records = SeqIO.parse('sequences.fasta', 'fasta')
SeqIO.write(reverse_complement_records(records), 'sequences_rc.fasta', 'fasta')
```
### Primer Design Helper
```python
def design_primer_pair(template, start, end):
'''Design forward and reverse primers for a region'''
forward = template[start:start + 20]
reverse = template[end - 20:end].reverse_complement()
return forward, reverse
template = Seq('ATGCGATCGATCGATCGATCGATCGATCGATCGATCGATCG')
fwd, rev = design_primer_pair(template, 0, 40)
print(f'Forward primer (5\'-3\'): {fwd}')
print(f'Reverse primer (5\'-3\'): {rev}')
```
### Handle Both Strands in Analysis
**Goal:** Search for a motif on both DNA strands.
**Approach:** Search the forward sequence, then search its reverse complement. Convert positions on the reverse strand back to forward-strand coordinates.
```python
def search_both_strands(seq, motif):
'''Search for a motif on both strands'''
motif = Seq(motif)
results = []
pos = seq.find(motif)
while pos != -1:
results.append(('+', pos))
pos = seq.find(motif, pos + 1)
rc = seq.reverse_complement()
pos = rc.find(motif)
while pos != -1:
results.append(('-', len(seq) - pos - len(motif)))
pos = rc.find(motif, pos + 1)
return results
seq = Seq('ATGCGAATTCGATCGATGAATTCGATC')
hits = search_both_strands(seq, 'GAATTC')
for strand, pos in hits:
print(f'Found on {strand} strand at position {pos}')
```
## Common Use Cases
| Task | Method |
|------|--------|
| Get opposite strand | `reverse_complement()` |
| Primer for opposite strand | `reverse_complement()` of target region |
| Template strand from coding | `reverse_complement()` |
| Check palindrome | `seq == seq.reverse_complement()` |
| Search both strands | Search original and reverse_complement |
## Common Errors
| Error | Cause | Solution |
|-------|-------|----------|
| Wrong bases in result | Mixing DNA/RNA methods | Use `reverse_complement_rna()` for RNA |
| `TypeError` | Passing string instead of Seq | Wrap in `Seq()` first |
## Decision Tree
```
Need to work with strand orientation?
├── Get opposite strand sequence (5' to 3')?
│ └── Use reverse_complement()
├── Get base-paired sequence (same direction)?
│ └── Use complement()
├── Working with RNA?
│ └── Use reverse_complement_rna()
├── Check if restriction site (palindrome)?
│ └── seq == seq.reverse_complement()
└── Designing primers?
└── Reverse primer = reverse_complement() of 3' end
```
## Related Skills
- seq-objects - Create Seq objects to complement
- transcription-translation - Six-frame translation uses reverse complement
- motif-search - Search both strands for motifs
- restriction-analysis/restriction-sites - Restriction sites are often palindromic
- alignment-files/sam-bam-basics - BAM FLAG indicates read strand; use samtools view -f 16 for reverse