crispr-offtarget-predictor

$npx mdskill add swaruplab/operon/crispr-offtarget-predictor

Predicts off-target sites for a given sgRNA sequence using mismatch analysis.

  • Identifies potential off-target binding sites to assess CRISPR specificity.
  • Uses read_file and run_shell_command tools for execution.
  • Scores mismatches and validates PAM to filter and rank off-targets.
  • Outputs a list of off-target locations with risk categories.

SKILL.md

.github/skills/crispr-offtarget-predictorView on GitHub ↗
---
name: 'crispr-offtarget-predictor'
description: 'Predicts potential off-target sites for a given sgRNA sequence using mismatch analysis.'
measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes.
allowed-tools:
  - read_file
  - run_shell_command
---

# CRISPR Off-Target Predictor

This skill identifies potential off-target binding sites for a specific sgRNA sequence. It helps researchers assess the specificity of their CRISPR design.

## When to Use This Skill

*   Designing new CRISPR experiments.
*   Validating sgRNA specificity before synthesis.
*   Analyzing potential safety risks in gene editing protocols.

## Core Capabilities

1.  **Mismatch Scoring**: Calculates mismatch penalties for potential sites.
2.  **PAM Validation**: Filters targets based on PAM (Protospacer Adjacent Motif) compatibility.
3.  **Risk Assessment**: Categorizes off-targets as Low, Medium, or High risk.

## Workflow

1.  **Input**: sgRNA sequence (20nt) and PAM (e.g., NGG).
2.  **Analysis**: Scans a reference library (mocked for this version) for similar sequences.
3.  **Output**: List of potential off-targets with locations and risk scores.

## Example Usage

**User**: "Check sgRNA 'GAGTCCGAGCAGAAGAAGAA' for off-targets."

**Agent Action**:
```bash
python3 Skills/Genomics/CRISPR_Prediction/impl.py --sequence GAGTCCGAGCAGAAGAAGAA --pam NGG
```

More from swaruplab/operon

SkillDescription
agentd-drug-discoveryUse the AgentD workflow to mine evidence, design molecules, and rank candidates with SAR plus ADMET annotations for early drug discovery tasks.
alphafold-databaseAccess AlphaFold 200M+ AI-predicted protein structures. Retrieve structures by UniProt ID, download PDB/mmCIF files, analyze confidence metrics (pLDDT, PAE), for drug discovery and structural biology.
antibody-design-agentAn advanced agent for de novo antibody design and optimization using state-of-the-art protein language models (MAGE, RFdiffusion).
archrSingle-cell ATAC-seq analysis with ArchR (R). The mature R-based scATAC pipeline — Arrow files, doublet inference, iterative LSI + Harmony, clustering, gene scores, MACS2 peak calling, motif enrichment, chromVAR deviations, footprinting, scRNA-seq integration (label transfer), trajectory analysis (built-in + Monocle3 + Slingshot), and ArchR's interactive genome browser. Sister protocol to snapatac2 — pick this for established R workflows.
automated-bioinformatics-pipelinesPipeline maestro
autonomous-biomedical-agentAutonomous biomedical AI agent framework for executing complex research tasks across genomics, drug discovery, molecular biology, and clinical analysis. Use this skill when conducting multi-step biomedical research including CRISPR screening design, single-cell RNA-seq analysis, ADMET prediction, GWAS interpretation, rare disease diagnosis, or lab protocol optimization. Leverages LLM reasoning with code execution and integrated biomedical databases.
autonomous-oncology-agentPrecision Oncology
basecallingConvert raw Nanopore signal data (FAST5/POD5) to nucleotide sequences using Dorado basecaller. Covers model selection, GPU acceleration, modified base detection, and quality filtering. Use when processing raw Nanopore data before alignment. Note: Guppy is deprecated; use Dorado for all new analyses.
batch-processingProcess multiple sequence files in batch using Biopython. Use when working with many files, merging/splitting sequences, or automating file operations across directories.
bindingdb-databaseQuery BindingDB for measured drug-target binding affinities (Ki, Kd, IC50, EC50). Search by target (UniProt ID), compound (SMILES/name), or pathogen. Essential for drug discovery, lead optimization, polypharmacology analysis, and structure-activity relationship (SAR) studies.