crispr-guide-design

$npx mdskill add swaruplab/operon/crispr-guide-design

Designs CRISPR sgRNAs with efficiency and off-target scoring.

  • Finds all PAM-compatible target sites in a gene or locus.
  • Uses run_shell_command and read_file for sequence processing.
  • Scores guides by efficiency, specificity, and GC content.
  • Returns ranked guides with coordinates, scores, and cloning oligos.

SKILL.md

.github/skills/crispr-guide-designView on GitHub ↗
---
name: crispr-guide-design
description: Guide foundry
keywords:
  - CRISPR
  - sgRNA
  - Doench
  - off-target
  - oligos
measurable_outcome: Return the requested number of guides (default ≥4) with efficiency + specificity scores, coordinates, and cloning oligos within 10 minutes per gene.
license: MIT
metadata:
  author: CRISPR-GPT Team
  version: "1.0.0"
compatibility:
  - system: Python 3.10+
allowed-tools:
  - run_shell_command
  - read_file
---

# CRISPR Design Agent

Automate sgRNA selection, scoring, off-target evaluation, and oligo generation for CRISPR experiments using the documented workflow.

## When to Use
- Designing CRISPR knockout/knock-in experiments that need validated guides.
- Locating all PAM-compatible target sites in a gene or locus.
- Filtering guides by efficiency/off-target metrics before cloning.

## Core Capabilities
1. **Target discovery:** Scan sequences for PAM motifs (e.g., NGG).
2. **Efficiency scoring:** Evaluate GC content, homopolymers, Doench/DeepCRISPR/CFD scores.
3. **Filtering & ranking:** Remove risky guides (SNP overlap, off-target hits) and output the best candidates.

## Workflow
1. Resolve gene symbol + organism to canonical transcript coordinates and target region.
2. Enumerate PAM-compatible sites; extract spacers for the chosen Cas variant.
3. Score guides (efficiency + specificity) and compute GC metrics.
4. Run off-target search (≤3 mismatches) to flag problematic loci.
5. Filter/rank guides, generate cloning oligos/primers, and emit JSON/CSV outputs with coordinates.

## Example Usage
```bash
python3 Skills/Genomics/CRISPR_Design_Agent/crispr_designer.py \
    --sequence "ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCAGACCTATGGAAACTGTGAGTGGATCCATTGGAAGGGC" \
    --output guides.json
```

## Guardrails
- Always state genome build and Cas variant assumptions.
- Avoid guides overlapping common SNPs when `avoid_variants` is true.
- Flag high off-target density near coding regions for manual review.

## References
- See `README.md` and `prompt.md` for detailed schema plus supporting literature.

More from swaruplab/operon

SkillDescription
agentd-drug-discoveryUse the AgentD workflow to mine evidence, design molecules, and rank candidates with SAR plus ADMET annotations for early drug discovery tasks.
alphafold-databaseAccess AlphaFold 200M+ AI-predicted protein structures. Retrieve structures by UniProt ID, download PDB/mmCIF files, analyze confidence metrics (pLDDT, PAE), for drug discovery and structural biology.
antibody-design-agentAn advanced agent for de novo antibody design and optimization using state-of-the-art protein language models (MAGE, RFdiffusion).
archrSingle-cell ATAC-seq analysis with ArchR (R). The mature R-based scATAC pipeline — Arrow files, doublet inference, iterative LSI + Harmony, clustering, gene scores, MACS2 peak calling, motif enrichment, chromVAR deviations, footprinting, scRNA-seq integration (label transfer), trajectory analysis (built-in + Monocle3 + Slingshot), and ArchR's interactive genome browser. Sister protocol to snapatac2 — pick this for established R workflows.
automated-bioinformatics-pipelinesPipeline maestro
autonomous-biomedical-agentAutonomous biomedical AI agent framework for executing complex research tasks across genomics, drug discovery, molecular biology, and clinical analysis. Use this skill when conducting multi-step biomedical research including CRISPR screening design, single-cell RNA-seq analysis, ADMET prediction, GWAS interpretation, rare disease diagnosis, or lab protocol optimization. Leverages LLM reasoning with code execution and integrated biomedical databases.
autonomous-oncology-agentPrecision Oncology
basecallingConvert raw Nanopore signal data (FAST5/POD5) to nucleotide sequences using Dorado basecaller. Covers model selection, GPU acceleration, modified base detection, and quality filtering. Use when processing raw Nanopore data before alignment. Note: Guppy is deprecated; use Dorado for all new analyses.
batch-processingProcess multiple sequence files in batch using Biopython. Use when working with many files, merging/splitting sequences, or automating file operations across directories.
bindingdb-databaseQuery BindingDB for measured drug-target binding affinities (Ki, Kd, IC50, EC50). Search by target (UniProt ID), compound (SMILES/name), or pathogen. Essential for drug discovery, lead optimization, polypharmacology analysis, and structure-activity relationship (SAR) studies.