bio-crispr-screens-mageck-analysis
$
npx mdskill add GPTomics/bioSkills/bio-crispr-screens-mageck-analysisAnalyze pooled CRISPR screens to identify essential genes and drug targets.
- Processes raw FASTQ data to quantify sgRNA representation and detect enrichment or depletion.
- Depends on the MAGeCK CLI tool for count normalization, ranking, and multi-condition analysis.
- Executes robust rank aggregation algorithms to determine gene significance across samples.
- Outputs normalized count matrices and gene rankings for downstream biological interpretation.
SKILL.md
.github/skills/bio-crispr-screens-mageck-analysisView on GitHub ↗
---
name: bio-crispr-screens-mageck-analysis
description: MAGeCK (Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout) for pooled CRISPR screen analysis. Covers count normalization, gene ranking, and pathway analysis. Use when identifying essential genes, drug targets, or resistance mechanisms from dropout or enrichment screens.
tool_type: cli
primary_tool: mageck
---
## Version Compatibility
Reference examples tested with: MAGeCK 0.5+, matplotlib 3.8+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python: `pip show <package>` then `help(module.function)` to check signatures
- CLI: `<tool> --version` then `<tool> --help` to confirm flags
If code throws ImportError, AttributeError, or TypeError, introspect the installed
package and adapt the example to match the actual API rather than retrying.
# MAGeCK CRISPR Screen Analysis
**"Analyze my pooled CRISPR screen with MAGeCK"** → Count sgRNA reads, normalize across samples, and rank genes by enrichment or depletion using the MAGeCK robust rank aggregation algorithm.
- CLI: `mageck count` → `mageck test` for standard analysis
- CLI: `mageck mle` for multi-condition designs
## Count sgRNAs from FASTQ
**Goal:** Quantify sgRNA representation from raw sequencing data.
**Approach:** Map FASTQ reads to the sgRNA library sequences with MAGeCK count, producing a normalized count matrix and QC summary across all samples.
```bash
# Count reads mapping to sgRNA library
mageck count \
-l library.csv \
-n experiment \
--sample-label Day0,Treated1,Treated2,Control1,Control2 \
--fastq Day0.fastq.gz Treated1.fastq.gz Treated2.fastq.gz Control1.fastq.gz Control2.fastq.gz \
--norm-method median
# Output files:
# experiment.count.txt - normalized counts
# experiment.count_normalized.txt - normalized counts
# experiment.countsummary.txt - QC summary
```
## Library File Format
```
# library.csv (tab-separated)
sgRNA_ID Gene Sequence
BRCA1_1 BRCA1 ATGGATTTATCTGCTCTTCG
BRCA1_2 BRCA1 CAGCAGATACTTGATGCATC
TP53_1 TP53 CCATTGTTCAATATCGTCCG
...
```
## MAGeCK Test (RRA Algorithm)
**Goal:** Identify genes significantly enriched or depleted between treatment and control conditions.
**Approach:** Run MAGeCK test with robust rank aggregation, which ranks sgRNAs by fold change, tests whether per-gene sgRNA rankings deviate from uniform, and reports gene-level significance with FDR correction.
```bash
# Compare treatment vs control
mageck test \
-k experiment.count.txt \
-t Treated1,Treated2 \
-c Control1,Control2 \
-n results \
--norm-method median \
--gene-test-fdr-threshold 0.25
# Output files:
# results.gene_summary.txt - gene-level results
# results.sgrna_summary.txt - sgRNA-level results
```
## MAGeCK MLE (Maximum Likelihood)
**Goal:** Estimate gene effects in complex experimental designs with multiple conditions or covariates.
**Approach:** Define a design matrix specifying sample-condition relationships, then run MAGeCK MLE which fits a generalized linear model to estimate per-gene beta scores (effect sizes) for each condition.
```bash
# Create design matrix
# design.txt:
# Samples baseline treatment
# Day0 1 0
# Control1 1 0
# Control2 1 0
# Treated1 1 1
# Treated2 1 1
mageck mle \
-k experiment.count.txt \
-d design.txt \
-n mle_results \
--norm-method median
# Output: mle_results.gene_summary.txt with beta scores
```
## Interpret Results
**Goal:** Extract significant essential and resistance genes from MAGeCK output.
**Approach:** Load the gene summary table, filter by negative-selection FDR for dropout/essential genes and positive-selection FDR for enriched/resistance genes, and rank by MAGeCK score.
```python
import pandas as pd
# Load gene summary
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Negative selection (dropout/essential)
essential = genes[(genes['neg|fdr'] < 0.05)].sort_values('neg|rank')
print(f'Essential genes (dropout): {len(essential)}')
print(essential[['id', 'neg|score', 'neg|fdr']].head(20))
# Positive selection (enrichment/resistance)
resistant = genes[(genes['pos|fdr'] < 0.05)].sort_values('pos|rank')
print(f'Resistance genes (enriched): {len(resistant)}')
print(resistant[['id', 'pos|score', 'pos|fdr']].head(20))
```
## Visualize Results
```python
import pandas as pd
import matplotlib.pyplot as plt
import numpy as np
genes = pd.read_csv('results.gene_summary.txt', sep='\t')
# Volcano plot
fig, ax = plt.subplots(figsize=(10, 8))
x = genes['neg|lfc']
y = -np.log10(genes['neg|fdr'])
colors = ['red' if fdr < 0.05 else 'gray' for fdr in genes['neg|fdr']]
ax.scatter(x, y, c=colors, alpha=0.5, s=10)
# Label top hits
top_hits = genes[genes['neg|fdr'] < 0.01].nsmallest(10, 'neg|rank')
for _, row in top_hits.iterrows():
ax.annotate(row['id'], (row['neg|lfc'], -np.log10(row['neg|fdr'])))
ax.axhline(-np.log10(0.05), linestyle='--', color='black', alpha=0.5)
ax.set_xlabel('Log2 Fold Change')
ax.set_ylabel('-log10(FDR)')
ax.set_title('MAGeCK Negative Selection')
plt.savefig('mageck_volcano.png', dpi=150)
```
## MAGeCK Pathway Analysis
```bash
# Gene set enrichment on screen results
mageck pathway \
-g results.gene_summary.txt \
-c go_biological_process.gmt \
-n pathway_results \
--pathway-fdr-threshold 0.25
```
## Time-Course Screens
```bash
# Compare multiple timepoints
mageck mle \
-k timecourse.count.txt \
-d timecourse_design.txt \
-n timecourse_results
# Design matrix for time course:
# Samples baseline day7 day14
# Day0 1 0 0
# Day7_R1 1 1 0
# Day7_R2 1 1 0
# Day14_R1 1 0 1
# Day14_R2 1 0 1
```
## CRISPR Activation (CRISPRa) Screens
```bash
# For CRISPRa, focus on positive selection
mageck test \
-k crispra.count.txt \
-t Activated1,Activated2 \
-c Control1,Control2 \
-n crispra_results
# Hits are genes where activation causes phenotype
# Use pos|fdr and pos|score columns
```
## MAGeCK-VISPR (Visualization)
```bash
# Generate interactive report
mageck-vispr run \
-n vispr_report \
-c config.yaml
# config.yaml example:
# experiment: screen_name
# assembly: hg38
# species: homo_sapiens
# targets: library.csv
# sgrnas: experiment.count.txt
# samples:
# - Day0
# - Treated1
```
## Related Skills
- screen-qc - Quality control before MAGeCK
- hit-calling - Alternative hit calling methods
- pathway-analysis/gsea - Downstream enrichment analysis
More from GPTomics/bioSkills
- bio-admet-predictionPredicts ADMET properties using ADMETlab 3.0 API or DeepChem models. Estimates bioavailability, CYP inhibition, hERG liability, and 119 toxicity endpoints with uncertainty quantification. Filters for PAINS and other structural alerts. Use when filtering compounds for drug-likeness or prioritizing leads by predicted safety.
- bio-alignment-amplicon-clippingTrim PCR primers from aligned reads in amplicon-panel BAMs using samtools ampliconclip. Use when processing SARS-CoV-2 ARTIC, hereditary cancer panels, ctDNA hot-spot panels, or any amplicon assay where primer-derived bases would falsely confirm reference at primer footprints.
- bio-alignment-filteringFilter alignments by flags, mapping quality, and regions using samtools view and pysam. Use when extracting specific reads, removing low-quality alignments, or subsetting to target regions.
- bio-alignment-indexingCreate and use BAI/CSI indices for BAM/CRAM files using samtools and pysam. Use when enabling random access to alignment files or fetching specific genomic regions.
- bio-alignment-ioRead, write, and convert multiple sequence alignment files using Biopython Bio.AlignIO. Supports Clustal, PHYLIP, Stockholm, FASTA, Nexus, and other alignment formats for phylogenetics and conservation analysis. Use when reading, writing, or converting alignment file formats.
- bio-alignment-msa-parsingParse and analyze multiple sequence alignments using Biopython. Extract sequences, identify conserved regions, analyze gaps, work with annotations, and manipulate alignment data for downstream analysis. Use when parsing or manipulating multiple sequence alignments.
- bio-alignment-msa-statisticsCalculate alignment statistics including sequence identity, conservation scores, substitution matrices, and similarity metrics. Use when comparing alignment quality, measuring sequence divergence, and analyzing evolutionary patterns.
- bio-alignment-multiplePerform multiple sequence alignment using MAFFT, MUSCLE5, ClustalOmega, or T-Coffee. Guides tool and algorithm selection based on dataset size, sequence divergence, and downstream application. Use when aligning three or more homologous sequences for phylogenetics, conservation analysis, or evolutionary studies.
- bio-alignment-pairwisePerform pairwise sequence alignment using Biopython Bio.Align.PairwiseAligner. Use when comparing two sequences, finding optimal alignments, scoring similarity, and identifying local or global matches between DNA, RNA, or protein sequences.
- bio-alignment-sortingSort alignment files by coordinate or read name using samtools and pysam. Use when preparing BAM files for indexing, variant calling, or paired-end analysis.